View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18058_low_17 (Length: 335)
Name: NF18058_low_17
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18058_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 10 - 232
Target Start/End: Complemental strand, 46407348 - 46407124
Alignment:
| Q |
10 |
aaaaatatgtactt-ctatgtcccaaattatgcggtgaatgaaaagccacgtgcaattttgaacctacaactcgtgtctgctacctgccagtgattgatt |
108 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46407348 |
aaaaaaatgtactttctatgtcccaaattatgcggtgaatgaaaagccacgtgcaattttaaacctacaactcgtgtctgctacctgccagtgattgatt |
46407249 |
T |
|
| Q |
109 |
gctttactttttcatatatctgaaatcagatatcacg-----atccttctgaccttagttagtagtaacgtttgaaagtgaaatttactgcctcccaacg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46407248 |
gctttactttttcatatatctgaaatcagatatcacgatctcatccttctgaccttagttagtagtaacgtttgaaagtgaaatttactgcctcccaacg |
46407149 |
T |
|
| Q |
204 |
ctctttctctctcgcaccccccaaaatca |
232 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
46407148 |
ctctt----tctcgcaccccccaaaatca |
46407124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 260 - 335
Target Start/End: Complemental strand, 46407096 - 46407021
Alignment:
| Q |
260 |
ctctctgaaactcaggagtggacgtaagcttctaaaattcagtgttctacttactctcaaacaaaacaattgactc |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46407096 |
ctctctgaaactcaggagtggacgtaagcttctaaaattcagtgttctacttactctcaaacaaaaaaattgactc |
46407021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University