View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18058_low_29 (Length: 267)
Name: NF18058_low_29
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18058_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 46406755 - 46406956
Alignment:
| Q |
1 |
ctatatattacaggctctgtctcgggaccccaccacttatctgaatgattgttttttattgaattatctgaaatgaatgatttatgattgtccttaaaat |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46406755 |
ctatgtattacaggctctgtctcgggaccccaccacttatctgaatgattgttttttattgaattatctgaaatgaatgatttatgattgtccttaaaat |
46406854 |
T |
 |
| Q |
101 |
aaataaatatattttaagagggaaatacggtacaannnnnnnngatggaattatctgaatgattgtcctttaaaatatggcaataatttaaggttccaag |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46406855 |
aaataaatacattttaagagggaaatacggtacaattttttttgatggaattatctgaatgattgtcctttaaaatatggcaataatttaaggttccaag |
46406954 |
T |
 |
| Q |
201 |
ac |
202 |
Q |
| |
|
|| |
|
|
| T |
46406955 |
ac |
46406956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University