View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18058_low_32 (Length: 253)
Name: NF18058_low_32
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18058_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 56 - 223
Target Start/End: Original strand, 3877636 - 3877803
Alignment:
| Q |
56 |
gaaatatggtttatgattaaacatggtaacataagccgaccccatttaatacgaaaatgtttgattcggtaactagtccatgaacggacaaatcggggtt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||| |
|
|
| T |
3877636 |
gaaatatggtttatgattaaacatggtaacataagccgaccccatttaatacgaaaatgtttgattcggtatctagtccatgaaccgacatatcggggtt |
3877735 |
T |
|
| Q |
156 |
caatctcatcaatcatttgccggacccatttaaagttaaaagaagaacatgagaagagggagtataat |
223 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3877736 |
caatctcatcgatcatttgccggacccatttaaagttaaaagaagaacatgagaagagggagtataat |
3877803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University