View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18058_low_45 (Length: 203)
Name: NF18058_low_45
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18058_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 33718561 - 33718421
Alignment:
| Q |
1 |
tctaggtctctttctcttgtttctgttattaaaagattgaaatgtgtaagataagttcttacgataatcttttcctcgagaacatttactataatgcgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33718561 |
tctaggtctctttctcttgtttctgttattaaaagattgaaatgtgtaagataagttcttacgataatcttttcctcgagagcatttactataatgcgaa |
33718462 |
T |
 |
| Q |
101 |
gtgaacaaaggaagtgaatttagtaggttttggataccaat |
141 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33718461 |
gtgaacaaaggaagtgaatgtagtaggttttggataccaat |
33718421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 145 - 203
Target Start/End: Complemental strand, 33718381 - 33718323
Alignment:
| Q |
145 |
gtacctgtatagagtttctttcttcctttctaccattttctctgggcgaggttgctttt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718381 |
gtacctgtatagagtttctttcttcctttctaccattttctctgggcgaggttgctttt |
33718323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University