View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18058_low_9 (Length: 421)
Name: NF18058_low_9
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18058_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 35 - 404
Target Start/End: Complemental strand, 43063173 - 43062806
Alignment:
| Q |
35 |
catgttatcatgtctcggtttcttctttgttgtatagcttccactccgtacatgataaagggtattagacaaacatcttttaaaaataaaaattaacaaa |
134 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43063173 |
catgttatcatgtctcagtttcttctttcttgtatagcttccactccgtacatgataaagggtattagacaaacatcttttaaaaataaaaattaacaaa |
43063074 |
T |
 |
| Q |
135 |
gtgatcgagggtgaagccaatacacataatgtgtggatattttggttaagtggtggattatctctgattggaaagaagtatcataaagaccgtttgcatg |
234 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43063073 |
gtgattgagggtgaagccaatacacataatgtg--gatattttggttaagtggtggattatctctgattggaaagaagtatcataaagaccgtttgcatg |
43062976 |
T |
 |
| Q |
235 |
ttttgtcaactcaactacattattgtagcaagttgcattaatgtgacttatgtccactaatatcaacaacatatcttttggtgcgattcctctattattt |
334 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062975 |
ttttgtcaacacaactacattattgtagcaagttgcattaatgtgactaatgtccactaatatcaacaacatatcttttggtgcgattcctctattattt |
43062876 |
T |
 |
| Q |
335 |
ctggggaaggtacaaaccattcataatatttttaaaatgttcctcagattcaaatattggctatagtcac |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
43062875 |
ttggggaaggtacaaaccattcataatatttttaaaatgttcctcagattcaaatattagttatagtcac |
43062806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University