View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1805_high_17 (Length: 201)
Name: NF1805_high_17
Description: NF1805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1805_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 10 - 188
Target Start/End: Complemental strand, 40776374 - 40776195
Alignment:
| Q |
10 |
tagattattctgtttgttgctagagatagagaaagtgcatagctttttccatgtgtgttaggttgccactcattcctcatcaaatttc-aaaggggaaat |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40776374 |
tagatttttctgtttgttgctagagatagagaaagtgcatagctttttccatgtgtgttaggttgccactcattcctcatcaaatttcaaaaggggaaat |
40776275 |
T |
|
| Q |
109 |
ggacaagctagttcaactcaacgagattttacgtccacaaaaaattcatataattttcacgaaaaacaattatattgttg |
188 |
Q |
| |
|
||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
40776274 |
ggacaagctagttcaacgcaacgagatttcaagtccacaaaaaattcatataattttaacgaaaaataattatattgttg |
40776195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University