View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18060_low_16 (Length: 207)
Name: NF18060_low_16
Description: NF18060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18060_low_16 |
 | |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0005 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 232188 - 232023
Alignment:
| Q |
1 |
ccagccacaatcttaacccttgctgcacatttggtgcatgaatcataataccaaccatacttggactcgataccgcaaattgttgcaagtacaatcacat |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
232188 |
ccagccacaatcttaacccttgccgcacatttggtgcatgaatcataataccaaccatacttggactcgataccgcaaattgttgcaagtacaatcacat |
232089 |
T |
|
| Q |
101 |
tgcatcgctgtttatnnnnnnncggcccaatcatatattatttaacactaaataacgataagtatt |
166 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
232088 |
tttatcgctgtttataaaaaaacggcccaatcatatattatttaacactaaataacgataagtatt |
232023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 14585187 - 14585351
Alignment:
| Q |
1 |
ccagccacaatcttaacccttgctgcacatttggtgcatgaatcataataccaaccatacttggactcgataccgcaaattgttgcaagtacaatcacat |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14585187 |
ccagccacaatcttaacccttgccgcacatttggtgcatgaatcataataccaaccatacttggactcgataccgcaaattgttgcaagtacaatcacat |
14585286 |
T |
|
| Q |
101 |
tgcatcgctgtttatnnnnnnncggcccaatcatatattatttaacactaaataacgataagtatt |
166 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14585287 |
tttatcgctgtttat-aaaaaacggcccaatcatatattatttaacactaaataacgataagtatt |
14585351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 11217871 - 11217813
Alignment:
| Q |
1 |
ccagccacaatcttaacccttgctgcacatttggtgcatgaatcataataccaaccata |
59 |
Q |
| |
|
||||| |||||| ||| |||| | |||||||||||||||| |||||||||||||||||| |
|
|
| T |
11217871 |
ccagcaacaatcgtaatccttccagcacatttggtgcatgcatcataataccaaccata |
11217813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 11228378 - 11228320
Alignment:
| Q |
1 |
ccagccacaatcttaacccttgctgcacatttggtgcatgaatcataataccaaccata |
59 |
Q |
| |
|
||||| |||||| ||| |||| | |||||||||||||||| |||||||||||||||||| |
|
|
| T |
11228378 |
ccagcaacaatcgtaatccttccagcacatttggtgcatgcatcataataccaaccata |
11228320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University