View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18061_high_33 (Length: 236)
Name: NF18061_high_33
Description: NF18061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18061_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 47236836 - 47236630
Alignment:
| Q |
13 |
attattcttaaccgttgcgcacatatgatactgatttaaattannnnnnnnaaaagtgatggaattaaaatgaaagtaattattgtccactgaaatctgg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47236836 |
attattcttaaccgttgcgcacatatgatactgatttaaattattttttaaaaaagtgatggaattaaaatgaaagtaattattgtccactgaaatctgg |
47236737 |
T |
 |
| Q |
113 |
ttttccaatatgaactaaaaaaccaactttaatttccattccggtcccagcattccctcactgccgtgggcacttttttatatcacattgccttacccta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47236736 |
ttttccaatatgaactaaaaaaccaactttaatttccattccggtcccagcattccctcactgccgtggacacttttttatatcacattgccttacccta |
47236637 |
T |
 |
| Q |
213 |
ttgattt |
219 |
Q |
| |
|
|| |||| |
|
|
| T |
47236636 |
tttattt |
47236630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University