View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18061_low_19 (Length: 276)
Name: NF18061_low_19
Description: NF18061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18061_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 40 - 272
Target Start/End: Complemental strand, 1455890 - 1455658
Alignment:
| Q |
40 |
atttgtggttgcagagatgaggttcctaagatccataaagcaagcagcaaacaaatatgttacgcaagtggaggacttgttatggtcacatgatgatgaa |
139 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1455890 |
atttgtggttggagagatgaggttcctaagatccataaagcaagcagcaaacaaatatgttacgcaagtggaggacttgttatggtcacatgatgatgaa |
1455791 |
T |
|
| Q |
140 |
gaaaaggaagagaactcagaaatttccctctcagatgatgtgtgggtgatttgcccattcaatgattgttcaattttgatgagttttgatgggcttgaaa |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1455790 |
gaaaaggaagagaactcagaaatttccctctcagatgatgtgtgggtgatttgtccattcaatgattgttcaattttgatgagttttgatgggcttgaaa |
1455691 |
T |
|
| Q |
240 |
tcgtgacaaaagccgagtgcccgtcatgtcaca |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1455690 |
tcgtgacaaaagccgagtgcccgtcatgtcaca |
1455658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University