View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18062_high_12 (Length: 222)
Name: NF18062_high_12
Description: NF18062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18062_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 206
Target Start/End: Original strand, 23434002 - 23434189
Alignment:
| Q |
19 |
gtatgttagatttatgaacctggaaagagaagggaaagaaaactctttcacagtatggctaggttagatgtcaataaccgcaagagaaagcgttgcttgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23434002 |
gtatgttagatttatgaacctggaaagagaagggaaagagaactctttcacagtatggctaggttagatgtcaataaccgcaagagaaagcgttgcttgt |
23434101 |
T |
 |
| Q |
119 |
ttggctcatgccgcatccttcgacttttctggagaccatgnnnnnnnnaatgaatgtttcttaccttgggatgtttatcataaaaaac |
206 |
Q |
| |
|
||||||||| |||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23434102 |
ttggctcataccgcatccttcggcttttctagagaccatgttttttttaatgaatgtttcttaccttgggatgtttatcataaaaaac |
23434189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University