View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18064_low_13 (Length: 249)
Name: NF18064_low_13
Description: NF18064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18064_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 40695816 - 40695587
Alignment:
| Q |
1 |
aaattacagtaaaaatcacattttaacaccgtaacattttgggcacaattgcggcatcacactacatcaaaccgcaacattttgctcacaaaaattattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40695816 |
aaattacagtaaaaatcacattttaaca--------ttttgggcacaatggcggcatcacactacatcaaaccgcaacattttgctcacaaaaattattt |
40695725 |
T |
 |
| Q |
101 |
ttctagctttcagtctttaattttatcatagatttaaggattttttaaaaggatttcggatattctaaagtgatgaagagtgttgataatgatataaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
40695724 |
ttctagctttcagtctttaattttatcatagatttgagggttttttaaaaggatttcggatattctaaagtgatgaaaa--gttgataatgatataaata |
40695627 |
T |
 |
| Q |
201 |
tgagattttatagaggaaataggaaatgtgtaaagtataa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40695626 |
tgagattttatagaggaaataggaaatgtgtaaagtataa |
40695587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University