View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18064_low_15 (Length: 249)
Name: NF18064_low_15
Description: NF18064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18064_low_15 |
 | |
|
| [»] scaffold0795 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0795 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: scaffold0795
Description:
Target: scaffold0795; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 128 - 239
Target Start/End: Original strand, 4130 - 4241
Alignment:
| Q |
128 |
tgttaaactaagcttccataaatttttattatatacaaagtgcaaagaaattaaatactagaatagagacaaagtctactaaagtcaatactaattttgt |
227 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4130 |
tgttaaactaagcttccacaaatttttattatatacaaagtgcaaagaaattaaatactagaatagagacaaagtctactaaagtcaatactaattttgt |
4229 |
T |
|
| Q |
228 |
gaatttcctttg |
239 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4230 |
gaatttcctttg |
4241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0795; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 3970 - 4101
Alignment:
| Q |
1 |
ttattgattgcatcattaggagagaaaactggcaacaacnnnnnnnnn-ggtgcgtattctcacctgcatattgatttgaagctagtgagtagtgttgct |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3970 |
ttattgatttcatcattaggagagaaaactggcaacaaaaaaaagaaaaggtacgtattctcacctgcatattgatttgaagctagtgagtagtgttgct |
4069 |
T |
|
| Q |
100 |
aaagaaggtcaagagaattgtgtgagtgtgtt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4070 |
aaagaaggtcaagagaattgtgtgagtgtgtt |
4101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University