View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18064_low_16 (Length: 236)
Name: NF18064_low_16
Description: NF18064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18064_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 105 - 221
Target Start/End: Complemental strand, 35385854 - 35385738
Alignment:
| Q |
105 |
gtcaagcttttagttcatgaagtctcattttgtttgtgctgatttgtctcaggaatgttcaataacaactaaccattaattaatatggccatttcaaaaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35385854 |
gtcaagcttttagttcatgaagtctcattttgtttgtgctgatttgtctcaggaatgttcactaacaactaaccattaattaatatggccatttcaaaaa |
35385755 |
T |
|
| Q |
205 |
tataatgttgagtatgt |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35385754 |
tataatgttgagtatgt |
35385738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35385965 - 35385917
Alignment:
| Q |
1 |
atgtttaaattagagttttgaaaattggctgctactcacacctttgatg |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35385965 |
atgtttaaattagagttttgaaaattggctgctactcacacctttgatg |
35385917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University