View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18064_low_17 (Length: 227)
Name: NF18064_low_17
Description: NF18064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18064_low_17 |
 | |
|
| [»] scaffold0795 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0795 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0795
Description:
Target: scaffold0795; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 3772 - 3996
Alignment:
| Q |
7 |
gaaagattcaaagataatctccaattgaatactcaaaagggaaattaaagaa-caaaaatatttaaaaaggcatgtaatttgattaccaaaacttgatct |
105 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3772 |
gaaaaatttaaagataatctccaattgaatactcaaaagggaaattaaagaaacaaaaatatttaaaaaggcatctaatttgattaccaaaacttgatct |
3871 |
T |
|
| Q |
106 |
caaact--gagtataaaaaataattttagttgataaatcaaacatggaaagggacaaaatttcaaaaatt-aagaaatggtttgagtaaatttatatgtt |
202 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3872 |
caaactttgagtataaaaaataattatagttgataaatcaaacatggaaagggacaaaatttcaaaaattaaagaaatggtttgagtaaatttatatgtt |
3971 |
T |
|
| Q |
203 |
attgatttcatcattaggagagaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3972 |
attgatttcatcattaggagagaaa |
3996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University