View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18064_low_4 (Length: 388)
Name: NF18064_low_4
Description: NF18064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18064_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 342; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 11 - 372
Target Start/End: Complemental strand, 33232510 - 33232149
Alignment:
| Q |
11 |
cataggttcaccatgaccaaaaactgtaacatgacgccctctacttagaagaacccatcctaatgggtcttgtttgagacatagcaactttcgtacagct |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33232510 |
cataggttcaccatgaccaaaaactgtaacatgacgccctctacttagaagaacccatcctaatgggtcttgtttgagacatagcaacttttttacagct |
33232411 |
T |
 |
| Q |
111 |
gtttgtatctcacagtctacgctgtctttgcatgttttgttttgttgttttcttccatctatacccatccaaaagtatgaaatctttgttgagttgtttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
33232410 |
gtttgtatctcacagtctacgctgtctttgcatgttttgttttgttgttttcttccatctatacccatccaaaagtatggaatctctgttgggttgtttt |
33232311 |
T |
 |
| Q |
211 |
ttcctagttggtggtaatcaatgttaacgtccacattttgtatggtttgatgttttttaatgcttccaattgctcttgtgaagtcttggatccactttgg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33232310 |
ttcctagttggtggtaatcaatgttaacgtccacattttgtatggtttgatgttttttaatgcttccaattgctcttgtgaagtcttggatccactttgg |
33232211 |
T |
 |
| Q |
311 |
gtcattgcctccatagatgaatatgtatctatcccagctcattttctgaatcatatggtaac |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33232210 |
gtcattgcctccatagatgaatatgtatctatcccagctcattttctgaatcatatggtaac |
33232149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 287 - 340
Target Start/End: Complemental strand, 33238729 - 33238676
Alignment:
| Q |
287 |
tgtgaagtcttggatccactttgggtcattgcctccatagatgaatatgtatct |
340 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
33238729 |
tgtgaagtcttggatccattttttgtcactgcctccatagatgaatatgtatct |
33238676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University