View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18065_high_32 (Length: 278)
Name: NF18065_high_32
Description: NF18065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18065_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 33 - 267
Target Start/End: Original strand, 42938959 - 42939191
Alignment:
| Q |
33 |
tcggtgatctagtaatgataaattaatagcagtgatggagtattggatttgtgggaaaaaggaggaaatttaaaaagcgctaaagattatctttgtcaaa |
132 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
42938959 |
tcggcgatctagtaatgataaattaattgcagtgatggggtattggatttgtggggaaaaggaggaaatttaaaaaggggtaaagattatct--gtcaaa |
42939056 |
T |
 |
| Q |
133 |
tcggggtgtaattaaaacttcgtatggtgttactaaaatttatcaatttatacaagaccaaaatgatgtgatggtatttatatcaatttcaatttaacat |
232 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42939057 |
tcggggtgtagttaaaacttggtagggtgtaactaaaatttatcaatttatacaagaccaaaatgatgtgatggaatttatatcaatttcaatttaacat |
42939156 |
T |
 |
| Q |
233 |
tattcatttttcagaagttaatctccgggcttcat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42939157 |
tattcatttttcagaagttaatctccgggcttcat |
42939191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 56 - 99
Target Start/End: Original strand, 25332204 - 25332247
Alignment:
| Q |
56 |
taatagcagtgatggagtattggatttgtgggaaaaaggaggaa |
99 |
Q |
| |
|
||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
25332204 |
taatagctgtgatggagtttaggatttgtgggaaaaaggaggaa |
25332247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University