View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18065_high_32 (Length: 278)

Name: NF18065_high_32
Description: NF18065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18065_high_32
NF18065_high_32
[»] chr8 (1 HSPs)
chr8 (33-267)||(42938959-42939191)
[»] chr2 (1 HSPs)
chr2 (56-99)||(25332204-25332247)


Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 33 - 267
Target Start/End: Original strand, 42938959 - 42939191
Alignment:
33 tcggtgatctagtaatgataaattaatagcagtgatggagtattggatttgtgggaaaaaggaggaaatttaaaaagcgctaaagattatctttgtcaaa 132  Q
    |||| |||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||| | ||||||||||||  ||||||    
42938959 tcggcgatctagtaatgataaattaattgcagtgatggggtattggatttgtggggaaaaggaggaaatttaaaaaggggtaaagattatct--gtcaaa 42939056  T
133 tcggggtgtaattaaaacttcgtatggtgttactaaaatttatcaatttatacaagaccaaaatgatgtgatggtatttatatcaatttcaatttaacat 232  Q
    |||||||||| ||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
42939057 tcggggtgtagttaaaacttggtagggtgtaactaaaatttatcaatttatacaagaccaaaatgatgtgatggaatttatatcaatttcaatttaacat 42939156  T
233 tattcatttttcagaagttaatctccgggcttcat 267  Q
    |||||||||||||||||||||||||||||||||||    
42939157 tattcatttttcagaagttaatctccgggcttcat 42939191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 56 - 99
Target Start/End: Original strand, 25332204 - 25332247
Alignment:
56 taatagcagtgatggagtattggatttgtgggaaaaaggaggaa 99  Q
    ||||||| |||||||||| | |||||||||||||||||||||||    
25332204 taatagctgtgatggagtttaggatttgtgggaaaaaggaggaa 25332247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University