View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18065_high_35 (Length: 253)
Name: NF18065_high_35
Description: NF18065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18065_high_35 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 8 - 253
Target Start/End: Complemental strand, 4294621 - 4294376
Alignment:
| Q |
8 |
gagtgagaagaaaccagcagctttagagtgcagtggatcaacaagaatgagtggtcctcttgtcggagacggcgagaagaacaatcgacgccggagaacg |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4294621 |
gagtgagcagaaaccagcagctttagagtgcagtggatcaacaagaatgagtggtcctcttgtcggagacggcgagaagaccaatcgacgccggagaacg |
4294522 |
T |
 |
| Q |
108 |
gaggtgatgctgctgattcttcgaggtttatgcatgggaagttctgttgtttctttgtcactaatgatcacagctaaacaaagcagttctgtttctatct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4294521 |
gaggtgatgctgctgattcttcgaggtttatgcatgggaagttctgttgtttctttgtcactaatgatcacagctaaacaaagcagttctgtttctatct |
4294422 |
T |
 |
| Q |
208 |
atggttttcacttaccagttcattctaagtggactttctctccttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4294421 |
atggttttcacttaccagttcattctaagtggactttctctccttc |
4294376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University