View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18065_high_37 (Length: 251)
Name: NF18065_high_37
Description: NF18065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18065_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 33758410 - 33758182
Alignment:
| Q |
16 |
caagaactatgtgattctctaaatcagatagctttaaaatacgcatgaattaactaagtattctggtttagcttaatttgttggatttgatattttactt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33758410 |
caagaactatgtgattctctaaatcagatagctttaaaatacgcatgaattaattaagtattctggtttagcttaatttgttggatttgatattttactt |
33758311 |
T |
 |
| Q |
116 |
ttgtccgaaataaaggaatcagcatgtttgaaacttttattgtagacgtggcttgcaacttctttgtctttttcatgcatgtatgcatctttgtaaattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33758310 |
ttgtccgaaataaaggaatcagcatgtttgaaac-tttattgtagacgtggcctgcaacttctttgtctttttcatgcatgtatgcatctttgtaaattt |
33758212 |
T |
 |
| Q |
216 |
tagaaagggttaaataaatttttcatctct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33758211 |
tagaaagggttaaataaatttttcatctct |
33758182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University