View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18065_low_25 (Length: 309)
Name: NF18065_low_25
Description: NF18065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18065_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 292
Target Start/End: Original strand, 4071972 - 4072263
Alignment:
| Q |
1 |
gaattggttcttttcattattactattattttgaaatttttgttacaatagtatatgagtattttgatgttgaaaaatggaaaatgatgtgtaatgagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4071972 |
gaattggttcttttcattattactattattttgaaatttttgttacaatagtatatgagtattttgatgttgaaaaatggaaaatgatgtgtaatgagat |
4072071 |
T |
|
| Q |
101 |
tcaacaccaactcttgagctcccacatttggtttaaaaagagcatcaaaatgttgttttgccacatcacaaactccaccttaacatgtaatttcttcaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4072072 |
tcaacaccaactcttgagctcccacatttggtttaaaaagagcatcaaaatgttgttttgccacatcacaaactccaccttgacatgtaatttcttcaca |
4072171 |
T |
|
| Q |
201 |
cccctttcattcaagaggttatattcacatttttcttctagctttgaaacgaggttcacaaatgaaaaaacttggttttcaaatctctttct |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4072172 |
cccctttcattcaagaggttatattcacatttttcttcttgctttgaatcgaggctcacaaatgaaaaaacttggttttcaaatctctttct |
4072263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University