View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18065_low_40 (Length: 239)
Name: NF18065_low_40
Description: NF18065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18065_low_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 44428994 - 44429214
Alignment:
| Q |
18 |
acatttgacataaagtatgcgattttaaaaagatgatgtattacaatannnnnnnnaaaaggatgattaagatggaaatatgtgatcgagttcaagtggt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44428994 |
acatttgacataaagtatgcgattataaaaagatgatgtattacaatattttttt-aaaaggatgattaagatggaaatatgtgatcgagttcaagtggt |
44429092 |
T |
 |
| Q |
118 |
caatcaatgatttttagttaagtgttcgttaggaagaatgtaagtttgaatctatgttaaaataattattgatcgaattttatttttctttcagtcgaat |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44429093 |
cgatcaatgatttttagttaagtgttcgttaggaagaatgtaaatttgaatctaggttaaaataattattgatcgaattttatttttctttcagtcgaat |
44429192 |
T |
 |
| Q |
218 |
ttcaggttatgaagacttactt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44429193 |
ttcaggttatgaagacttactt |
44429214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University