View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18065_low_42 (Length: 229)
Name: NF18065_low_42
Description: NF18065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18065_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 4294122 - 4294317
Alignment:
| Q |
17 |
agtaatcagaaatgaactcaacttttcttttttagaggtgaactcaaccttttatcaatgaatattttcttaatttccttcacattattctcaacatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4294122 |
agtaatcagaaatgaactcaacttttcttttttagaggtgaactcaaccttttatcaatgaatattttcttaatttccttcacattattctcaacatttt |
4294221 |
T |
 |
| Q |
117 |
attttttgaagcacacactattcacaacataagaaacagttttttagttagttcagaaacacaacatacattgcttttatttcctccttttctctc |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4294222 |
attttttgaagtacacactattcacaacataagaaacagttttttagttagttcagaaacacaacatacattgcttttatttcttccttttctctc |
4294317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University