View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18065_low_43 (Length: 219)
Name: NF18065_low_43
Description: NF18065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18065_low_43 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 11345526 - 11345308
Alignment:
| Q |
1 |
agggaacgtcaaggtatgtacatcattataattataattcatgtactctactagaagaaatggaaataaccactagtttgtggatgtttgtttaggcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11345526 |
agggaacgtcaaggtatgtacatcattataattataattcatgtactctactagaagaaatggaaataaccactagtttgtggatgtttgtttaggcatt |
11345427 |
T |
 |
| Q |
101 |
aattctaatatagaactctcaaaaattgtttaatggttcaaactccacctaacgaatgcatccaaccaaccctgctacaatgaatgcgaacaatttggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11345426 |
aattctaatatagaactctcaaaaattgtttaatggttcaaactccacctaacgaatgcatccaaccaaccctgctacaatgaatgcgaacaatttggat |
11345327 |
T |
 |
| Q |
201 |
atgtcagagaagagaaagg |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11345326 |
atgtcagagaagagaaagg |
11345308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University