View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18066_low_5 (Length: 227)
Name: NF18066_low_5
Description: NF18066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18066_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 9738480 - 9738674
Alignment:
| Q |
19 |
gaaatcccagtcccaatcccagacccaatatataacccttctccaaagggtacatgtcctatagatgcacttaagttaggtgtgtgtgcaaatttgttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9738480 |
gaaatcccagtcccaatcccagacccaatatataacccttctccaaagggtacatgtcctatagatgcacttaagttaggtgtgtgtgcaaatttgttga |
9738579 |
T |
 |
| Q |
119 |
acttggtcaaagttaaattggggtccccaccaacactcccttgttgctcactcattcaaggtcttgctgatcttgaagctgctgcttgcctttgc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9738580 |
acttggtcaaagttaaattggggtccccaccaacactcccttgttgctcactcattcaaggtcttgctgatcttgaagctgctgcttgcctttgc |
9738674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University