View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18067_high_4 (Length: 238)

Name: NF18067_high_4
Description: NF18067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18067_high_4
NF18067_high_4
[»] chr2 (2 HSPs)
chr2 (20-119)||(38832605-38832704)
chr2 (188-230)||(38832750-38832792)


Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 20 - 119
Target Start/End: Original strand, 38832605 - 38832704
Alignment:
20 ctcatacttgatgttgtataatcatattgaatacaccatcactcgctattacatatacaatttcgttagatgaatgattttgtgagcaagtagagttgta 119  Q
    |||||||||||||||||||||||||||||||||||||||||||| | | || ||||||||||||||||||||||||||||||||||||||||||||||||    
38832605 ctcatacttgatgttgtataatcatattgaatacaccatcactcacaactagatatacaatttcgttagatgaatgattttgtgagcaagtagagttgta 38832704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 230
Target Start/End: Original strand, 38832750 - 38832792
Alignment:
188 gcaagttgttgtgttaagaattaagatcgactttagatgatgt 230  Q
    |||||||||||||| |||||| ||||||||||||| |||||||    
38832750 gcaagttgttgtgtcaagaatcaagatcgactttatatgatgt 38832792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University