View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18067_high_5 (Length: 215)
Name: NF18067_high_5
Description: NF18067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18067_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 47462236 - 47462057
Alignment:
| Q |
18 |
caaccgccccgttattgtcggatatatcgacaatacttcagacaatgattctctcaacgggtccaactcaaatgatccaaaccatttttcttcatttttg |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47462236 |
caaccggcccgttattgtcggatatatcgacaatacttcagacaatgattctctcaacgggtccaactcaaatgatccaaaccatttttcttcatttttg |
47462137 |
T |
 |
| Q |
118 |
taatagtatatcaaatgcagtgtatgataactcataccatggtctacacccgtcaacttgtgggtcttacccgaactcac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47462136 |
taatagtatatcaaatgcagtgtatgataactcataccatggtctacacccgtcaacttgtggctcttacccgaactcac |
47462057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University