View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18067_low_4 (Length: 249)
Name: NF18067_low_4
Description: NF18067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18067_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 8840316 - 8840553
Alignment:
| Q |
1 |
agtggcgtcagatcaacaggacgggcaatcagatcatcaggatcaaccagaagaattcgaaacgaattttcctggttatcctgatgaggcgattgtttgt |
100 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8840316 |
agtggtgtcggatcaacaggacgggcaatcagatcatcaggatcaaccagaagaattcgaaacgaattttcctggttatcctgatgaggcgattgtttgt |
8840415 |
T |
|
| Q |
101 |
atgagtaagattgtgggggagatgttgatcggaggatatgaaagtgagtgttgtcaggtgtacattgtggcgagaaggaccgcgttcgaggagattcaac |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8840416 |
atgagcaagattgtgggggagatgttgatcggaggatatgaaagtgagtgttgtcaggtgtacattgtggcgagaaggaccgcgttcgaggagattcaac |
8840515 |
T |
|
| Q |
201 |
agcagctggggctggaaagaatcagtattgatgatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8840516 |
agcagctggggctggaaagaatcagtattgatgatatt |
8840553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University