View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18067_low_7 (Length: 238)
Name: NF18067_low_7
Description: NF18067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18067_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 20 - 119
Target Start/End: Original strand, 38832605 - 38832704
Alignment:
| Q |
20 |
ctcatacttgatgttgtataatcatattgaatacaccatcactcgctattacatatacaatttcgttagatgaatgattttgtgagcaagtagagttgta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | | || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38832605 |
ctcatacttgatgttgtataatcatattgaatacaccatcactcacaactagatatacaatttcgttagatgaatgattttgtgagcaagtagagttgta |
38832704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 230
Target Start/End: Original strand, 38832750 - 38832792
Alignment:
| Q |
188 |
gcaagttgttgtgttaagaattaagatcgactttagatgatgt |
230 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
38832750 |
gcaagttgttgtgtcaagaatcaagatcgactttatatgatgt |
38832792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University