View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18067_low_9 (Length: 230)
Name: NF18067_low_9
Description: NF18067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18067_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 18 - 123
Target Start/End: Original strand, 40818254 - 40818363
Alignment:
| Q |
18 |
gaattgagcactttttcattattttttaattagtt----gaatattattatgttgttgagtgttttacagttatgattttccaacgaggcactactttac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40818254 |
gaattgagcactttttcattattttttaattaattaattgaatattattatgttgttgagtgttttacagttatgattttccaacgaggcactactttac |
40818353 |
T |
|
| Q |
114 |
gcgccactta |
123 |
Q |
| |
|
|||||||||| |
|
|
| T |
40818354 |
gcgccactta |
40818363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 192
Target Start/End: Original strand, 40818389 - 40818456
Alignment:
| Q |
121 |
ttagttatacttatcaatttgcgtccgtctatggggatatgggtgggactgcccaactaaattaggtattag |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40818389 |
ttagttatacttatcaatttgcgtccgtctatggggat----ctgggactgcccaactaaattaggtattag |
40818456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University