View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_high_100 (Length: 235)
Name: NF18068_high_100
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_high_100 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 151 - 216
Target Start/End: Original strand, 23794413 - 23794480
Alignment:
| Q |
151 |
ttaatggtcgtgttagtgtagcttgaatggtagctcaatg--tattggtatgcagacgttgaggtttg |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23794413 |
ttaatggtcgtgttagtgcagcttgaatggtagctcaatgtatattggtatgcagacgttgaggtttg |
23794480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 151 - 216
Target Start/End: Original strand, 23765195 - 23765262
Alignment:
| Q |
151 |
ttaatggtcgtgttagtgtagcttgaatggtagctcaatg--tattggtatgcagacgttgaggtttg |
216 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23765195 |
ttaatggccgtgttagtgcagcttgaatggtagctcaatgtatattggtatgcagacgttgaggtttg |
23765262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University