View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_high_103 (Length: 228)
Name: NF18068_high_103
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_high_103 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 6975028 - 6975213
Alignment:
| Q |
16 |
aaaatgggggctgctcccccaaggtcgcaactatatgctatcatattaatcatgatttttgaatcacttttgatgacaagtttgacaagtgcatcaaact |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6975028 |
aaaatgggggctgctcccctaaggtcgcaactatatgctatcatattaatcatgatttttgaatcacttttgatgac---------aagtgcatcaaact |
6975118 |
T |
|
| Q |
116 |
atataacaagaaaaataggagtaagtttatcgtttttattgagattgacgtcaacatatcaatttacttgatttatttaaattaaatgcaattaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6975119 |
atataacaagaaaaataggagtaagtttatcgtctttactgagattgtcgtcaacttatcaatttacttgatttatttaaattaaatgcaattaa |
6975213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University