View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_high_36 (Length: 411)
Name: NF18068_high_36
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_high_36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 12 - 411
Target Start/End: Original strand, 31047567 - 31047961
Alignment:
| Q |
12 |
atcaagtttgtgaaatttgtcatctttttcttgttgtcaatggaaaaggaaagtagtgtgctggttgacccaccctccattatttggtcatgtcctgtct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31047567 |
atcaagtttgtgaaatttgtcatctttttcttgttgtcaatggaaaaggaaagtagtgtgctggttgacccaccctccattatttggtcatgtcctgtct |
31047666 |
T |
 |
| Q |
112 |
gtaaattggagatatttattttcannnnnnnagttttattatgttgaggagtttaatttcgttattgacaaaaacaatttttgagaagagacaaatctta |
211 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
31047667 |
gtaaattggagatatttattttcatttttttagttttattatgttgaggagtttaatttcgttattgtcaaaaactatttttgagaagagacaaatctta |
31047766 |
T |
 |
| Q |
212 |
gaaaagaacttcattgtactatactcaaagaatttatccatatactgtagatagatgtatatga-nnnnnnnnnngaagaagaaaatgtatagaaatata |
310 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
31047767 |
gaaaagaacttcactctactatactcaaagaatttatccatata-----gatagatgtatatgatttttttttttttttttgaagatgtatagaaatata |
31047861 |
T |
 |
| Q |
311 |
tatatcatctttatcgannnnnnnngttgctgttattatcattatctagtggacagtactcttcaattatttctggctcatcaaggaaaaggatggtgtg |
410 |
Q |
| |
|
|||| |||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31047862 |
tatagcatctttatcgattttttta-ttgctataattatcattatctagtggacagtactcttcaattatttatggctcatcaaggaaaaggatggtgtg |
31047960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University