View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_high_55 (Length: 349)
Name: NF18068_high_55
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 48153751 - 48153412
Alignment:
| Q |
1 |
tatgtctgaagtttctctttattatgaagtggatatcgaactgctccaatgcatgtggcagaagctgatcaagctcaccttgctggccgaaggggccgtg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153751 |
tatgtctgaagtttctctttgttatgaagtggatatcgaactgctccaatgcatgtggcagaagctgatcaagctcaccttgctggccgaaggggccgtg |
48153652 |
T |
 |
| Q |
101 |
g---------gcatgggcgtggtcatgttcttatgcctgtggttgagggaccatatccgcaacatccagaagccgatcaagctcaccttgctggtggaag |
191 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153651 |
gtggccgtgggcatgggcgtggtcatgttcttatgcctgtggttgagggaccatatccgcaacatccagaagccgatcaagctcaccttgctggtggaag |
48153552 |
T |
 |
| Q |
192 |
gggccgtggtgggcgtggtcgtgttcgtaggcgctatgatacacctctaccaccaattgaacccgtctttgattttattaggactcaagtagcctttctt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48153551 |
gggccgtggtgggcgtggtcgtgttcgtaggcgctatgatacacctctaccaccaattgaacccgtctttgattttattaggactcaagtagcctctctt |
48153452 |
T |
 |
| Q |
292 |
gagactatggttgacaacaaggtagaaactaaggtgaaag |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153451 |
gagactatggttgacaacaaggtagaaactaaggtgaaag |
48153412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University