View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_high_67 (Length: 321)
Name: NF18068_high_67
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_high_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 303
Target Start/End: Original strand, 2694504 - 2694794
Alignment:
| Q |
13 |
gaagaaaatttcataggtggaggcgcctaagaaaggaaagcaacagtgggctgatcgtggtagaaacactcatgttggtacctcaggagttgctaccacc |
112 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2694504 |
gaagagaatttcagaggtggaggcgcctaagaaaggaaagcaacagtgggctgatcatggtagaaatactcatgttggtacctcaggagttgctaccacc |
2694603 |
T |
|
| Q |
113 |
ggggtggttgagcgtacattagttcctcaagaagtgctcgaggagaatcatgaggtatcaaaggaacttccaggttgggatgtaggtcaagaagctgtcc |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| | || |||||||||| ||| | ||| |
|
|
| T |
2694604 |
ggggcggttgagcgtacattagttcctcaacaagtactcgaggagaatcatgaggtatcaaaggaacttccagatcggcatgtaggtcataaagttttcc |
2694703 |
T |
|
| Q |
213 |
attctgaggaggtatatgtgaacacagatgaaacagaaattgtgcatgggaagccgaaacagattgcgaattctaaagctagtacgtcatt |
303 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
2694704 |
gttctgatgaggaatatgtgaacacaaatgaaacagaaactgtgcatgggaagccgaagcagattgcgaattctaaagctagtacctcatt |
2694794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University