View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_high_69 (Length: 316)
Name: NF18068_high_69
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_high_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 2 - 298
Target Start/End: Original strand, 42339332 - 42339628
Alignment:
| Q |
2 |
aagaaatactggaaatcaaagaagaaatagagaacatcgataggacaattgcaatgtacaacggtcgtatagcctactaccaacgtgaggtcctaataga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42339332 |
aagaaatactggaaatcaaagaagaaatagagaacatcgataggacaattgcaatgtacaacagtcgtataacctactaccaacgtgaggtcctaataga |
42339431 |
T |
|
| Q |
102 |
aaagaaatgcttgaaagaccaacaagagacgttacttatggctcaatctatatcgaaatgctttgatggtggtagatcgagcagtggaagaggaagcggt |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
42339432 |
aaagaaatgcttggaagaccaacaagagacgttacttatggctcaatctaatttgaaatgctttgatggtggtagaacgagcagtggaagaggaagtggt |
42339531 |
T |
|
| Q |
202 |
ggtagaggtcgattcaacagtctttcctctttttgttgtcgtactactgttttgctgataacatcctatttgtctttttatgttaaaattttctttt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
42339532 |
ggtagaggtcgattcaacagtctttcctctttttgttgtcgtactactgttttgctgataacatcctatttgtctttttatgttgaaactttctttt |
42339628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 301
Target Start/End: Original strand, 42339758 - 42339834
Alignment:
| Q |
224 |
tttcctctttttgttgtcgtactactgttttgctgataacatcctatttgtctttttatgttaaaattttctttttga |
301 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
42339758 |
tttcctctttttct-gtcgtactactgttttgctgatagcatcctatttgtttttttatgttgaaattttctttttga |
42339834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University