View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_high_80 (Length: 282)
Name: NF18068_high_80
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_high_80 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 275
Target Start/End: Original strand, 45832661 - 45832918
Alignment:
| Q |
18 |
gatggtatggttcaggtgcagtcaattttctctgaaaatgctcgtataggagtactccttgaaggacttatgctttgcttcaacggggctaggatcctca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45832661 |
gatggtatggttcaggtgcagtcaattttctctgaaaatgctcgtataggagtactccttgaaggacttatgctttgcttcaacggggctaggatcctca |
45832760 |
T |
|
| Q |
118 |
agagtagtcgaatgcaaatttcacgaattcccagtgtctctgctagtccatctgatgcaaaagagcatgtggtcacaacatgggattgggtaatccaagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45832761 |
agagtagtcgaatgcaaatttcacgaattcccagtgtctctgctagtccatctgatgcaaaagagcatgtggtcacaacatgggattgggtaatccaagg |
45832860 |
T |
|
| Q |
218 |
tctcgaagttcacatttgcatgccatacagattgcaattgcgtgccattgatgatgtc |
275 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45832861 |
tcttgaagttcacatttgcatgccatacagattgcaattgcgtgccattgatgatgtc |
45832918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 23 - 273
Target Start/End: Complemental strand, 28128820 - 28128570
Alignment:
| Q |
23 |
tatggttcaggtgcagtcaattttctctgaaaatgctcgtataggagtactccttgaaggacttatgctttgcttcaacggggctaggatcctcaagagt |
122 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |||||||||| || |||||||||| ||| | || || ||||| || ||| | |||||| |
|
|
| T |
28128820 |
tatggttcaagtgcagtcaattttctctgagaatgctagtataggagtgctatttgaaggactaatgatcaattttaatggggccagaatcttgaagagt |
28128721 |
T |
|
| Q |
123 |
agtcgaatgcaaatttcacgaattcccagtgtctctgctagtccatctgatgcaaaagagcatgtggtcacaacatgggattgggtaatccaaggtctcg |
222 |
Q |
| |
|
||| | |||||||||||||||||||| || | ||||||||| ||||||||||||| | | || | |||||||||||| |||||||| ||||||||| |
|
|
| T |
28128720 |
agtaggatgcaaatttcacgaattcctagcatatctgctagtgcatctgatgcaaagggacctgcagccacaacatgggactgggtaattcaaggtctct |
28128621 |
T |
|
| Q |
223 |
aagttcacatttgcatgccatacagattgcaattgcgtgccattgatgatg |
273 |
Q |
| |
|
| || ||||||| |||||||||||||| |||||||||| |||||||||| |
|
|
| T |
28128620 |
atgtctacatttgtttgccatacagattggaattgcgtgctattgatgatg |
28128570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University