View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_high_97 (Length: 242)
Name: NF18068_high_97
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_high_97 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 119 - 209
Target Start/End: Complemental strand, 39994584 - 39994494
Alignment:
| Q |
119 |
ccctaaatctcaatctctattcattgaagcaccggacaatttcatcattcctaatcgatcgtcgatttctcgttgtttcttcgtgttttca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39994584 |
ccctaaatctcaatctctattcattgaagcaccgcacaatttcatcattcctaatcgatcgtcgatttctcgttgtttcttcgtgttttca |
39994494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University