View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_low_103 (Length: 248)
Name: NF18068_low_103
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_low_103 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 46310585 - 46310403
Alignment:
| Q |
1 |
ccacaagaaaacaagcttttggatgcttctccgttgtaacaggcagcagtatcattgaagggctgttgaagaaaaagtactactactaccctaggctgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46310585 |
ccacaagaaaacaagcttttggatgcttctccgttgtaacaggcagcagtatcattgaagggctgttgaagaaaaagtactactactaccctaggctgaa |
46310486 |
T |
 |
| Q |
101 |
actagtctaaagataaccaccgatgcggctgtagagtaaccattaaaggatttcatttgttgagattgcagaatggtgattgt |
183 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
46310485 |
actagtctaaagataaccacggatgcggctgtagagtaaccattaaaggatttcctttgttgagattgcagaatgttgattgt |
46310403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 146 - 233
Target Start/End: Complemental strand, 46309701 - 46309616
Alignment:
| Q |
146 |
aaggatttcatttgttgagattgcagaatggtgattgtgttgaaatttacttcgtgtgttgctaatatatattttcttccaagttcat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46309701 |
aaggatttcatttgttgagattgcagaatggtgattgtgttgaaatttacttc--gtgttgctaatatatattttcttccaagttcat |
46309616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University