View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_low_45 (Length: 402)
Name: NF18068_low_45
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 1 - 388
Target Start/End: Complemental strand, 54878768 - 54878383
Alignment:
| Q |
1 |
gatattaatttttaatccaacattgaattttatatatgatataaggcccatataaatttccaaccaattaaataaagtatacgtaaggaacattggtgaa |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| | ||||| ||| ||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
54878768 |
gatataaatttttaatccaacattgaattttatatatgatatacgacccatttaattttccaaccaattaaataaagtatacgtaaggaacatggatgaa |
54878669 |
T |
|
| Q |
101 |
tgagaatttttgcgtgataagcaaacacaataaattggaaattagttatatcttacgtttgaaagatagcaataacagggtaacatggtgagctctgtcc |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54878668 |
tgagaatttttgcgtgataagcaaatacaataaatgagatattagttatatcttacgtttgaaagatagcaataacagggtaacatggtgagctctgtcc |
54878569 |
T |
|
| Q |
201 |
aattctttacttgtttaatttaggcaattcatttcatcacacgtatattatatggaagaattatagggaaaggtattgctcaagaagcatatgtgccaaa |
300 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54878568 |
aattctttacttg-----tttaggcaattcatttcatcacacgtatattatatgggagaattatagggaaaggtattgctcaagaagcatatgtgccaaa |
54878474 |
T |
|
| Q |
301 |
tagagaaa---tgttggcctgtattgtatcaaacttgaaaaaggctttcaaggtccgaaacttgcctacattctgtttgttctgcagcttg |
388 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54878473 |
tagagagatgttgttggcctgtattgtatcaaacttgaaaaaggctttcaaggtccgaaacttgcctacattctgtttgttctgcagcttg |
54878383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University