View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_low_68 (Length: 338)
Name: NF18068_low_68
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 136 - 328
Target Start/End: Complemental strand, 30400134 - 30399942
Alignment:
| Q |
136 |
tgctgtcttttttagattctggaagatgggtgagatctataatgaagtaaaactaaactaccactgcattgttatgtaacaatgtgttgcattgttttga |
235 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30400134 |
tgctgtcttttttagattccggaagatgggtgagatctataatgaagtaaaactaaactaccactgcattgttatgtaacaatgtgttgcattgttttga |
30400035 |
T |
 |
| Q |
236 |
agattgaggtgaaatgaagtgttatggttgaaatgggtgaaagaaaatgagaggatgaaactaaaaggttgcatttttatgttggtgatgatg |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30400034 |
agattgaggtgaaatgaagtgttatggttgaaatgggtgaaagaaaatgagaggatgaaactaaaaggttgcatttttatgttggtgatgatg |
30399942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 30400246 - 30400188
Alignment:
| Q |
24 |
tttcagtccctttgaactactcttcctagtggctttactactattggaacccatgaccc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30400246 |
tttcagtccctttgaactactcttcctagtggctttgctactattggaacccatgaccc |
30400188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University