View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_low_72 (Length: 326)
Name: NF18068_low_72
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_low_72 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 70 - 305
Target Start/End: Original strand, 12350532 - 12350767
Alignment:
| Q |
70 |
aatcatgatccaaaaaatctctctaaatccatatcctctgacctctctcttcctccttacctgccgtacttctccccttcaaaatccaatttctttctta |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12350532 |
aatcatgatccaaaaaatctctctaaatccatatcctctgacctctctcttcctccttacctgccgtacttctccccttcaaaatccaatttctttctta |
12350631 |
T |
 |
| Q |
170 |
accatgtagactagagcagtgatggtgcaacaaggtcccctccgcgctatcttttcaccctgtttggggttgctatactcctatgtgggcgcagttctca |
269 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12350632 |
accatgtagactagagcagcgatggtgcaacaaggtcccctctgcgctatcttttcaccctgtttggggttgctatactcttatgtgggcgcagttctca |
12350731 |
T |
 |
| Q |
270 |
tgcgctcaaccatgcctcttcttccgccatcgtcgt |
305 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12350732 |
tgcgctcaaccacgcctcttcttccgccatcgtcgt |
12350767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 12350496 - 12350524
Alignment:
| Q |
18 |
gatttctcgtctctaatatgcacatagta |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12350496 |
gatttctcgtctctaatatgcacatagta |
12350524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University