View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18068_low_74 (Length: 325)
Name: NF18068_low_74
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18068_low_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 310
Target Start/End: Original strand, 12511657 - 12511950
Alignment:
| Q |
17 |
aggtttctattctttaggagtttagagggttttgctaactagcaataaaggaaaagtttcttttaaaaatataattcttttccactaacttaaaatttaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12511657 |
aggtttctattctttaggagtttagagggttttgctaactagcaataaaggaaaagtttcttttaaaaatataattcttttccactgacttaaaatttaa |
12511756 |
T |
|
| Q |
117 |
ataaccatttgannnnnnnattagcgcttagttttacgtgatctaaataatttataatatttcttatctttcacatatctcattgaagagtattacgagc |
216 |
Q |
| |
|
||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
12511757 |
ataaccacttgatttttttattaacgcttagttttacgtgatctaaataatttataatatttcttgtctttcacatatctcattaaagagtattacgagc |
12511856 |
T |
|
| Q |
217 |
cgtcttgaccgtactttgatgttaggtgtaggatgtgtatgttgttgtaagttagtggaccctttctatggatgtctcgtactattaccctttg |
310 |
Q |
| |
|
||| ||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12511857 |
cgttttgaccgcactttaatgtcaggtgtaggatgtgtatgttgttgtaagttagtggaccctttctatggatgtctcgtactattaccctttg |
12511950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University