View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18069_high_4 (Length: 295)
Name: NF18069_high_4
Description: NF18069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18069_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 9666140 - 9665857
Alignment:
| Q |
1 |
tgataattgggggtgttgtgagagagaatgagggaaggtgtgtagagatagtaggagtaaggagggttgttgttgttgttggtattgaaaaatgggattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666140 |
tgataattgggggtgttgtgagagagaataagggaaggtgtgtagagaaagtaggagtaaggagggttgttgttgttgttggtattgaaaaatgggattg |
9666041 |
T |
|
| Q |
101 |
gataattctcgaaggttctggaagcgtcggaaatgcgacggagggtgatgatctgggtgagtttatagagtgatttgcaggttagggagatgttggcgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666040 |
gataattctcgaaggttctggaagcgtcggaaatgcgacggagggtgatgatttgggtgagtttatagagtgatttgcaggttagggagatgttggcgag |
9665941 |
T |
|
| Q |
201 |
ttgtgtatgggttaggtatggtagaattagggttgcgtgttgaacaagaaatgatgatgatgatgaagagtttgaatcacctttgct |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
9665940 |
ttgtgtatgggttaggtatggtagaattagggttgcgtgttgaacaagaaatg---atgacgatgaagagtttgaatcaccattgct |
9665857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University