View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1806_high_13 (Length: 203)
Name: NF1806_high_13
Description: NF1806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1806_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 16 - 185
Target Start/End: Complemental strand, 40586896 - 40586728
Alignment:
| Q |
16 |
aaaatcaaatttagctagcatcaaaacttaaacctatnnnnnnnncaaaatgtttactctcataatattggaacaccatttgctagaaaagaaaatgaag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586896 |
aaaatcaaatttagctagcatcaaaacttaaacctataaaaaaa-caaaatgtttactctcataatattggaacaccatttgctagaaaagaaaatgaag |
40586798 |
T |
|
| Q |
116 |
gtgaaaaatagttgcgtttctttcacatagcatatatagcatctctttagtccatttctttttagtgtac |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586797 |
gtgaaaaatagttgcgtttctttcacatagcatatatagcatctctttagtccatttctttttagtgtac |
40586728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University