View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1806_low_10 (Length: 268)
Name: NF1806_low_10
Description: NF1806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1806_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 22 - 117
Target Start/End: Original strand, 23440279 - 23440374
Alignment:
| Q |
22 |
ctgctcacccaaaattacactcctctaaatcaaataaccccttctcatcaccttagctgaggcacacctgaaaggattctattccaacacgtaggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
23440279 |
ctgctcacccaaaattacactcctctaaatcaaataaccccttctcatcaccttagctgaggcacacctgaaagggtcctattccaacacgtaggc |
23440374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 154 - 252
Target Start/End: Original strand, 23440411 - 23440514
Alignment:
| Q |
154 |
gcaaaaactagtcacatagtgtgggaaacgagtaaa-----atgctttcagacttctcacttcatctgaatagaaagttaaagtgaagattttcaaattg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23440411 |
gcaaaaactagtcacatagtgtgggaaacgagtaaattaaaatgctttcagacttctcacttcatctgaatagaaagttaaagtgaagattttcaaattg |
23440510 |
T |
 |
| Q |
249 |
taca |
252 |
Q |
| |
|
|||| |
|
|
| T |
23440511 |
taca |
23440514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 160 - 253
Target Start/End: Complemental strand, 23871567 - 23871473
Alignment:
| Q |
160 |
actagtcacatagtgtgggaaacgagtaaaatgctttcagacttctcacttcatctgaa-tagaaagttaaagtgaagattttcaaattgtacag |
253 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||| ||||| |||||| |||| ||||| |||||| | |||||||| |||| ||||||||||| |
|
|
| T |
23871567 |
actagtcacagagtgttggaaatgagtaaaatgctctcagatttctcatttcaactgaattagaaactgaaagtgaacatttcaaaattgtacag |
23871473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 17819659 - 17819719
Alignment:
| Q |
22 |
ctgctcacccaaaattacactcctctaaatcaaataaccccttctcatcaccttagctgag |
82 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
17819659 |
ctgctcaccccaaaaaaaactcctctaaatcaaacaacctcttctcgtcaccttagctgag |
17819719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University