View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1806_low_14 (Length: 204)
Name: NF1806_low_14
Description: NF1806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1806_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 39101421 - 39101592
Alignment:
| Q |
15 |
ctgtgaactgtgcttctaaatcgagtttttcaactcatgattcatcgttagcaggagattcggtgaaatcctcttcggctggtttgaatcatgatgaaga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39101421 |
ctgtgaactgtgcttctaaatcgagtttttcaactcatgattcatcgttagcaggggattcggtgaaatcctcttcggctggtttgaatcatgatgaaga |
39101520 |
T |
|
| Q |
115 |
tgatgctgtgaatgaagttcgtgattcgaaggtgttgaatggtggtggtgtagctgggagtgtggcggggat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39101521 |
tgatgctgtgaatgaagttcgtgattcgaaggtgttgaatggtggtggtgtagctgggagtgtggcggggat |
39101592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University