View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1806_low_4 (Length: 374)
Name: NF1806_low_4
Description: NF1806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1806_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 207
Target Start/End: Complemental strand, 42746464 - 42746268
Alignment:
| Q |
11 |
gatgaataaacaaaagggtcatcattatgtagaagaaatgagttcttcctctaaggttgttatagttgcagtgaaagcttcaaaatatatttcaagaact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42746464 |
gatgaataaacaaaagggtcatcattatgtagaagaaatgagttcttcctctaaggttgttatagttgcagtgaaagcttcaaaatatatttcaagaact |
42746365 |
T |
|
| Q |
111 |
gctttggtttgggctttgactcatgttgttcaaccaggggattgcattaagcttttggttatcattcctgaactttcttcaagtattgtcattactc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42746364 |
gctttggtttgggctttgactcatgttgttcaaccaggggattgcattaagcttttggttatcattcctgaactttcttcaagtattgtcattactc |
42746268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 272 - 357
Target Start/End: Complemental strand, 42746203 - 42746118
Alignment:
| Q |
272 |
gtcatgctttaatattgattactttgagaaaaaagaaaatttgaattaagaagttgcatatagaaaatgatacacgagactagagt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42746203 |
gtcatgctttaatattgattactttgaggaaaaagaaaatttgaattaagaagttgcatatagaaaatgacacacgagactagagt |
42746118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University