View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1807-Insertion-13 (Length: 329)
Name: NF1807-Insertion-13
Description: NF1807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1807-Insertion-13 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 157 - 329
Target Start/End: Complemental strand, 24448854 - 24448682
Alignment:
| Q |
157 |
gctatagttttgtgtgttaccttcatcatggtaggaacccaaaatcttcgaccatctgcatctcttccaaaggttgtagtgtatggctgtgatcgagtca |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24448854 |
gctatagttttgtgtgttaccttcatcatggtaggaacccaaaatcttcgaccatctgcatctcttccaaaagttgtagtgtatggctgtgatcgagtca |
24448755 |
T |
|
| Q |
257 |
tatgccataaccaataatgatagaaaacaagaatgagaaacccgcatggtacaagtagcatatccatataata |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24448754 |
tatgccataaccaataatgatagaaaacaagaatgagaaacccgcatggtacaagtagcatatccatataata |
24448682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 168 - 310
Target Start/End: Complemental strand, 24463526 - 24463384
Alignment:
| Q |
168 |
gtgtgttaccttcatcatggtaggaacccaaaatcttcgaccatctgcatctcttccaaaggttgtagtgtatggctgtgatcgagtcatatgccataac |
267 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||||| ||||||||||| ||||| | |||||| |||||||| || | ||||||| |
|
|
| T |
24463526 |
gtgtgttaccttcataatggctggaacccaatgccttcgaccatctgcgtctcttccaaatgttgtgttcattggctgagatcgagtaattttccataac |
24463427 |
T |
|
| Q |
268 |
caataatgatagaaaacaagaatgagaaacccgcatggtacaa |
310 |
Q |
| |
|
| ||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
24463426 |
aagaaatgatataaaacaaggatgagaaacccacatggtacaa |
24463384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University