View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1807-Insertion-22 (Length: 43)
Name: NF1807-Insertion-22
Description: NF1807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1807-Insertion-22 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 10218605 - 10218570
Alignment:
| Q |
8 |
aaacctttctcctaaaccgaatgaagcctttttctt |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10218605 |
aaacctttctcctaaaccgaatgaagcctttttctt |
10218570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 11050411 - 11050376
Alignment:
| Q |
8 |
aaacctttctcctaaaccgaatgaagcctttttctt |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11050411 |
aaacctttctcctaaaccgaatgaagcctttttctt |
11050376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University