View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18070_high_6 (Length: 265)
Name: NF18070_high_6
Description: NF18070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18070_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 2670125 - 2670371
Alignment:
| Q |
1 |
gaagtggttcatggaatggtcaatcttttggtggagtaccaatactaagcacaatagctgctcttaatgataaaatagttgttgatgaacatgaagctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2670125 |
gaagtggttcatggaatggtcaatcttttggtggagtaccaatactaagcacaatagctgctcttaatgataaaatagttgttgatgaacatgaagctta |
2670224 |
T |
 |
| Q |
101 |
ttattatcctgcagggttgttgcagtctaatttatctagacttgttgtgaattcgaccggttcaatggaacgttatgcatggatcgaaagcactaaagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2670225 |
ttattatcctgcagggttgttgcagtctaatttatctagacttgttgtgaattcgaccagttcaatggaacgttatgcatggatcgaaagcactaaagat |
2670324 |
T |
 |
| Q |
201 |
tggaacaaagtatggtctgcaccagttcttcaatgtgataattatgg |
247 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2670325 |
tggaacaaagtatggtctgcaccagctcttcaatgtgataattatgg |
2670371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University