View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_high_100 (Length: 219)
Name: NF18071_high_100
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_high_100 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 5 - 182
Target Start/End: Complemental strand, 25370655 - 25370478
Alignment:
| Q |
5 |
ttgctaaatttcaggatttagaggttaactttaataagattcagtataccaccaaaagtggtatttgaccttttgtttattgttagtacttttatgttta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25370655 |
ttgctaaatttcaggatttagaggttaactttaataagattcagtataccaccaaaagtggtatttgaccttttgtttattgttagtacttttatgttta |
25370556 |
T |
 |
| Q |
105 |
cgnnnnnnngttgcaagtacaaaatatatgactattgatgactannnnnnnnnnaaggaagccttgtgttgccatgtt |
182 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25370555 |
cgtttttttgttgcaagtacaaaatatatgactattgatgactattttttttttaaggaagccttgtgttgccatgtt |
25370478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University