View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18071_high_100 (Length: 219)

Name: NF18071_high_100
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18071_high_100
NF18071_high_100
[»] chr5 (1 HSPs)
chr5 (5-182)||(25370478-25370655)


Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 5 - 182
Target Start/End: Complemental strand, 25370655 - 25370478
Alignment:
5 ttgctaaatttcaggatttagaggttaactttaataagattcagtataccaccaaaagtggtatttgaccttttgtttattgttagtacttttatgttta 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25370655 ttgctaaatttcaggatttagaggttaactttaataagattcagtataccaccaaaagtggtatttgaccttttgtttattgttagtacttttatgttta 25370556  T
105 cgnnnnnnngttgcaagtacaaaatatatgactattgatgactannnnnnnnnnaaggaagccttgtgttgccatgtt 182  Q
    ||       |||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||    
25370555 cgtttttttgttgcaagtacaaaatatatgactattgatgactattttttttttaaggaagccttgtgttgccatgtt 25370478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University